Design CRISPR gRNA sequences for specific gene exons with off-target prediction and efficiency scoring. Trigger when user needs gRNA design, CRISPR guide RNA selection, or genome editing target analysis.
Design optimal guide RNA (gRNA) sequences for CRISPR-Cas9 genome editing. Supports on-target efficiency scoring and off-target prediction.
| Parameter | Type | Required | Description |
|---|---|---|---|
gene_symbol | string | Yes | HGNC gene symbol (e.g., TP53, BRCA1) |
target_exon | int | No | Specific exon number (default: all coding exons) |
genome_build | string | No | Reference genome: hg38 (default), hg19, mm10 |
pam_sequence | string |
| No |
| PAM motif: NGG (default), NAG, NGCG |
guide_length | int | No | gRNA length in bp (default: 20) |
gc_content_min | float | No | Minimum GC% (default: 30) |
gc_content_max | float | No | Maximum GC% (default: 70) |
poly_t_threshold | int | No | Max consecutive T's (default: 4) |
off_target_check | bool | No | Enable off-target prediction (default: true) |
max_mismatches | int | No | Max mismatches for off-target (default: 3) |
{
"gene": "TP53",
"genome": "hg38",
"guides": [
{
"id": "TP53_E2_G1",
"exon": 2,
"sequence": "GAGCGCTGCTCAGATAGCGATGG",
"pam": "NGG",
"position": "chr17:7669609-7669631",
"strand": "+",
"gc_content": 52.2,
"efficiency_score": 0.78,
"off_target_count": 2,
"off_targets": [...],
"warnings": []
}
]
}
Combines multiple position-specific features:
score = w1*position_score + w2*gc_score + w3*secondary_score + w4*poly_t_score
max_mismatchespython scripts/main.py --gene TP53 --exon 4 --output results.json
python scripts/main.py --gene BRCA1 --max-mismatches 2 --gc-min 35 --gc-max 65
python scripts/main.py --gene-list genes.txt --genome mm10 --pam NAG
⚠️ Difficulty: HIGH - Requires manual verification before experimental use
See references/ for:
scoring_algorithms.pdf - Deep learning models (DeepCRISPR, CRISPRon)off_target_databases/ - GUIDE-seq validated datasetsefficiency_benchmarks/ - Doench et al. 2014/2016 rulesCore script: scripts/main.py
Key functions:
fetch_gene_sequence() - Retrieve exon sequences from Ensemblfind_pam_sites() - Identify PAM-adjacent target sitesscore_efficiency() - Calculate on-target scorespredict_off_targets() - Bowtie2/BWA alignment for off-targetsrank_guides() - Multi-criteria optimizationOptional:
| Risk Indicator | Assessment | Level |
|---|---|---|
| Code Execution | Python scripts with bioinformatics tools | High |
| Network Access | Ensembl API calls for gene sequences | High |
| File System Access | Read/write genome data and results | Medium |
| Instruction Tampering | Scientific computation guidelines | Low |
| Data Exposure | Genome data handled securely | Medium |
# Python dependencies
pip install -r requirements.txt
# Optional tools
# bowtie2 (for local off-target alignment)
# ViennaRNA (for secondary structure prediction)