MAGeCK (Model-based Analysis of Genome-wide CRISPR-Cas9 Knockout) for pooled CRISPR screen analysis. Covers count normalization, gene ranking, and pathway analysis. Use when identifying essential genes, drug targets, or resistance mechanisms from dropout or enrichment screens.
Reference examples tested with: MAGeCK 0.5+, matplotlib 3.8+, numpy 1.26+, pandas 2.2+
Before using code patterns, verify installed versions match. If versions differ:
pip show <package> then help(module.function) to check signatures<tool> --version then <tool> --help to confirm flagsIf code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
"Analyze my pooled CRISPR screen with MAGeCK" → Count sgRNA reads, normalize across samples, and rank genes by enrichment or depletion using the MAGeCK robust rank aggregation algorithm.
mageck count → mageck test for standard analysismageck mle for multi-condition designsGoal: Quantify sgRNA representation from raw sequencing data.
Approach: Map FASTQ reads to the sgRNA library sequences with MAGeCK count, producing a normalized count matrix and QC summary across all samples.
# Count reads mapping to sgRNA library
mageck count \
-l library.csv \
-n experiment \
--sample-label Day0,Treated1,Treated2,Control1,Control2 \
--fastq Day0.fastq.gz Treated1.fastq.gz Treated2.fastq.gz Control1.fastq.gz Control2.fastq.gz \
--norm-method median
# Output files:
# experiment.count.txt - normalized counts
# experiment.count_normalized.txt - normalized counts
# experiment.countsummary.txt - QC summary
# library.csv (tab-separated)
sgRNA_ID Gene Sequence
BRCA1_1 BRCA1 ATGGATTTATCTGCTCTTCG
BRCA1_2 BRCA1 CAGCAGATACTTGATGCATC
TP53_1 TP53 CCATTGTTCAATATCGTCCG
...
Goal: Identify genes significantly enriched or depleted between treatment and control conditions.
Approach: Run MAGeCK test with robust rank aggregation, which ranks sgRNAs by fold change, tests whether per-gene sgRNA rankings deviate from uniform, and reports gene-level significance with FDR correction.
# Compare treatment vs control
mageck test \
-k experiment.count.txt \
-t Treated1,Treated2 \
-c Control1,Control2 \
-n results \
--norm-method median \
--gene-test-fdr-threshold 0.25
# Output files:
# results.gene_summary.txt - gene-level results
# results.sgrna_summary.txt - sgRNA-level results
Goal: Estimate gene effects in complex experimental designs with multiple conditions or covariates.
Approach: Define a design matrix specifying sample-condition relationships, then run MAGeCK MLE which fits a generalized linear model to estimate per-gene beta scores (effect sizes) for each condition.
# Create design matrix
# design.txt:
# Samples baseline treatment
# Day0 1 0
# Control1 1 0
# Control2 1 0
# Treated1 1 1
# Treated2 1 1
mageck mle \
-k experiment.count.txt \
-d design.txt \
-n mle_results \
--norm-method median
# Output: mle_results.gene_summary.txt with beta scores
Goal: Extract significant essential and resistance genes from MAGeCK output.
Approach: Load the gene summary table, filter by negative-selection FDR for dropout/essential genes and positive-selection FDR for enriched/resistance genes, and rank by MAGeCK score.
import pandas as pd
# Load gene summary
genes = pd.read_csv('results.gene_summary.txt', sep='\t')
# Negative selection (dropout/essential)
essential = genes[(genes['neg|fdr'] < 0.05)].sort_values('neg|rank')
print(f'Essential genes (dropout): {len(essential)}')
print(essential[['id', 'neg|score', 'neg|fdr']].head(20))
# Positive selection (enrichment/resistance)
resistant = genes[(genes['pos|fdr'] < 0.05)].sort_values('pos|rank')
print(f'Resistance genes (enriched): {len(resistant)}')
print(resistant[['id', 'pos|score', 'pos|fdr']].head(20))
import pandas as pd
import matplotlib.pyplot as plt
import numpy as np
genes = pd.read_csv('results.gene_summary.txt', sep='\t')
# Volcano plot
fig, ax = plt.subplots(figsize=(10, 8))
x = genes['neg|lfc']
y = -np.log10(genes['neg|fdr'])
colors = ['red' if fdr < 0.05 else 'gray' for fdr in genes['neg|fdr']]
ax.scatter(x, y, c=colors, alpha=0.5, s=10)
# Label top hits
top_hits = genes[genes['neg|fdr'] < 0.01].nsmallest(10, 'neg|rank')
for _, row in top_hits.iterrows():
ax.annotate(row['id'], (row['neg|lfc'], -np.log10(row['neg|fdr'])))
ax.axhline(-np.log10(0.05), linestyle='--', color='black', alpha=0.5)
ax.set_xlabel('Log2 Fold Change')
ax.set_ylabel('-log10(FDR)')
ax.set_title('MAGeCK Negative Selection')
plt.savefig('mageck_volcano.png', dpi=150)
# Gene set enrichment on screen results
mageck pathway \
-g results.gene_summary.txt \
-c go_biological_process.gmt \
-n pathway_results \
--pathway-fdr-threshold 0.25
# Compare multiple timepoints
mageck mle \
-k timecourse.count.txt \
-d timecourse_design.txt \
-n timecourse_results
# Design matrix for time course:
# Samples baseline day7 day14
# Day0 1 0 0
# Day7_R1 1 1 0
# Day7_R2 1 1 0
# Day14_R1 1 0 1
# Day14_R2 1 0 1
# For CRISPRa, focus on positive selection
mageck test \
-k crispra.count.txt \
-t Activated1,Activated2 \
-c Control1,Control2 \
-n crispra_results
# Hits are genes where activation causes phenotype
# Use pos|fdr and pos|score columns
# Generate interactive report
mageck-vispr run \
-n vispr_report \
-c config.yaml
# config.yaml example:
# experiment: screen_name
# assembly: hg38
# species: homo_sapiens
# targets: library.csv
# sgrnas: experiment.count.txt
# samples:
# - Day0
# - Treated1