Discover novel miRNAs and quantify known miRNAs using miRDeep2 de novo prediction from small RNA-seq data. Use when identifying new miRNAs or performing comprehensive miRNA profiling with discovery.
Reference examples tested with: pandas 2.2+
Before using code patterns, verify installed versions match. If versions differ:
pip show <package> then help(module.function) to check signatures<tool> --version then <tool> --help to confirm flagsIf code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
"Discover novel miRNAs from my small RNA-seq data" → Identify known and novel miRNAs by mapping reads to the genome and scoring precursor hairpin structures using a probabilistic model.
mapper.pl for read mapping, miRDeep2.pl for de novo miRNA predictionCollapsed reads (FASTA)
|
v
mapper.pl ---------> Align to genome, create ARF file
|
v
miRDeep2.pl -------> Predict novel miRNAs, quantify known
|
v
quantifier.pl -----> Quantify known miRNAs only (optional)
Goal: Build a bowtie index from the reference genome for miRDeep2 read mapping.
Approach: Run bowtie-build on the genome FASTA to create the index files required by mapper.pl.
# Build bowtie index for miRDeep2 mapper
bowtie-build genome.fa genome_index
Goal: Collapse identical reads and align them to the reference genome.
Approach: Use mapper.pl to clip adapters, filter by length, collapse duplicates, and map with bowtie to produce ARF alignment files.
# Collapse reads and map to genome
mapper.pl reads.fastq \
-e \
-h \
-i \
-j \
-k TGGAATTCTCGGGTGCCAAGG \
-l 18 \
-m \
-p genome_index \
-s reads_collapsed.fa \
-t reads_vs_genome.arf \
-v
# Key options:
# -e: Input is FASTQ
# -h: Parse Illumina headers
# -k: Clip 3' adapter
# -l 18: Discard reads < 18 nt
# -m: Collapse reads
# -p: Bowtie index prefix
# -s: Output collapsed FASTA
# -t: Output ARF alignment file
Goal: Predict novel miRNAs and quantify known miRNAs from aligned small RNA reads.
Approach: Run miRDeep2.pl with collapsed reads, genome, alignments, and miRBase references to score candidate miRNA loci.
# Predict novel miRNAs
miRDeep2.pl \
reads_collapsed.fa \
genome.fa \
reads_vs_genome.arf \
mature_ref.fa \
mature_other.fa \
hairpin_ref.fa \
-t Human \
2> report.log
# Arguments:
# 1. Collapsed reads FASTA
# 2. Genome FASTA
# 3. Alignment ARF file
# 4. Known mature miRNAs (same species)
# 5. Known mature miRNAs (other species, for conservation)
# 6. Known hairpin precursors
# -t: Species for miRBase lookup
Goal: Download and extract species-specific miRNA references from miRBase.
Approach: Fetch mature and hairpin FASTA files from miRBase, then grep species-specific entries by prefix.
# Download from miRBase
wget https://www.mirbase.org/download/mature.fa
wget https://www.mirbase.org/download/hairpin.fa
# Extract species-specific sequences
grep -A1 ">hsa-" mature.fa > mature_human.fa
grep -A1 ">hsa-" hairpin.fa > hairpin_human.fa
Goal: Quantify expression of known miRNAs without running novel discovery.
Approach: Run quantifier.pl with hairpin and mature references against collapsed reads for fast quantification.
# If not doing novel discovery
quantifier.pl \
-p hairpin_human.fa \
-m mature_human.fa \
-r reads_collapsed.fa \
-t hsa
# Output: miRNAs_expressed_all_samples.csv
| File | Description |
|---|---|
| result_*.html | Interactive results report |
| result_*.csv | Predicted novel miRNAs with scores |
| miRNAs_expressed_all_samples*.csv | Expression quantification |
| pdfs_*.pdf | Secondary structure plots |
Score interpretation:
>10: High confidence novel miRNA
5-10: Medium confidence
1-5: Low confidence, needs validation
<1: Likely false positive
Key metrics:
- miRDeep2 score: Overall confidence
- Total read count: Expression level
- Mature/star ratio: Strand bias (expect asymmetry)
- Randfold p-value: Structural stability
Goal: Load miRDeep2 prediction and quantification results into pandas DataFrames.
Approach: Parse tab-delimited output files and filter novel miRNA predictions by confidence score threshold.
import pandas as pd
def parse_mirdeep2_results(csv_path):
'''Parse miRDeep2 novel miRNA predictions'''
df = pd.read_csv(csv_path, sep='\t', skiprows=1)
# Filter high-confidence predictions
# Score > 10 indicates high confidence novel miRNA
high_conf = df[df['miRDeep2 score'] > 10]
return high_conf
# Parse quantification results
def parse_quantifier_output(csv_path):
'''Parse quantifier.pl expression matrix'''
df = pd.read_csv(csv_path, sep='\t')
return df