Analyze PacBio Iso-Seq data for full-length isoform discovery and quantification. Use when characterizing transcript diversity or identifying novel splice variants.
Reference examples tested with: minimap2 2.26+, pandas 2.2+, pysam 0.22+, samtools 1.19+
Before using code patterns, verify installed versions match. If versions differ:
pip show <package> then help(module.function) to check signaturespackageVersion('<pkg>') then ?function_name to verify parameters<tool> --version then <tool> --help to confirm flagsIf code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
"Analyze full-length isoforms from my Iso-Seq data" → Process PacBio HiFi reads through CCS generation, primer removal, clustering, and isoform classification to discover novel transcript variants.
isoseq3 refine → isoseq3 cluster → pbmm2 align → sqanti3_qc.py# Full pipeline: subreads -> HQ transcripts
# 1. CCS: Generate circular consensus sequences
# 2. Lima: Remove primers and demultiplex
# 3. Refine: Remove polyA and concatemers
# 4. Cluster: Group into isoforms
# 5. Polish: Generate high-quality consensus (optional with HiFi)
# Generate CCS from subreads (skip if using HiFi reads)
ccs input.subreads.bam ccs.bam \
--min-rq 0.9 \
--min-passes 3 \
--num-threads 32
# For HiFi reads, CCS is already done
# Start directly from HiFi reads
# Iso-Seq specific primer removal
lima ccs.bam primers.fasta demux.bam \
--isoseq \
--peek-guess \
--num-threads 16
# Output: demux.primer_5p--primer_3p.bam
# Lima reports also contain demux statistics
# Check lima report
cat demux.lima.summary
>primer_5p
AAGCAGTGGTATCAACGCAGAGTACATGGG
>primer_3p
AAGCAGTGGTATCAACGCAGAGTAC
# Remove polyA tails and concatemers
isoseq3 refine demux.primer_5p--primer_3p.bam primers.fasta refined.bam \
--require-polya \
--min-polya-length 20
# Output: refined.bam (full-length non-chimeric reads)
# Also: refined.filter_summary.json
# Check refinement stats
cat refined.filter_summary.json | jq
# Cluster similar transcripts
isoseq3 cluster refined.bam clustered.bam \
--verbose \
--use-qvs \
--num-threads 32
# Output files:
# - clustered.bam: Clustered transcripts
# - clustered.hq_transcripts.fasta: High-quality consensus
# - clustered.lq_transcripts.fasta: Low-quality consensus
# - clustered.cluster_report.csv: Cluster membership
# Map HQ transcripts to reference genome
minimap2 -ax splice:hq \
-uf \
--secondary=no \
reference.fa \
clustered.hq_transcripts.fasta \
| samtools sort -o aligned.bam
samtools index aligned.bam
# For downstream analysis
pbmm2 align reference.fa clustered.bam aligned.bam \
--preset ISOSEQ \
--sort
# Collapse mapped transcripts
isoseq3 collapse aligned.bam collapsed.gff
# Output:
# - collapsed.gff: Collapsed transcript models
# - collapsed.abundance.txt: Read counts per isoform
# - collapsed.group.txt: Isoform groupings
# Convert to GTF
gffread collapsed.gff -T -o collapsed.gtf
# Classify isoforms against reference annotation
sqanti3_qc.py \
clustered.hq_transcripts.fasta \
reference.gtf \
reference.fa \
-o sqanti_output \
--aligner_choice minimap2 \
--cage_peak cage_peaks.bed \
--polyA_motif_list polyA_motifs.txt \
--cpus 16
# Key output files:
# - sqanti_output_classification.txt: Per-isoform metrics
# - sqanti_output_junctions.txt: Splice junction details
# - sqanti_output.params.txt: Run parameters
| Category | Code | Description |
|---|---|---|
| Full Splice Match | FSM | All junctions match reference |
| Incomplete Splice Match | ISM | Subset of reference junctions |
| Novel In Catalog | NIC | Novel combination of known junctions |
| Novel Not in Catalog | NNC | Contains novel junction |
| Antisense | AS | Overlaps gene on opposite strand |
| Genic | G | Within gene but no junction match |
| Intergenic | IR | Between genes |
| Fusion | FU | Spans multiple genes |
# Filter artifacts using SQANTI3 rules
sqanti3_filter.py \
sqanti_output_classification.txt \
--isoforms clustered.hq_transcripts.fasta \
--gtf collapsed.gtf \
--faa predicted_proteins.faa \
-o sqanti_filtered
# Custom filtering
python << 'EOF'
import pandas as pd
classification = pd.read_csv('sqanti_output_classification.txt', sep='\t')
# Keep FSM, ISM, NIC with evidence
keep = classification[
(classification['structural_category'].isin(['full-splice_match', 'incomplete-splice_match', 'novel_in_catalog'])) &
(classification['FL'] >= 2) &
(classification['bite'] == 'FALSE')
]
keep['isoform'].to_csv('filtered_isoforms.txt', index=False, header=False)
EOF
# PacBio's isoform quantification tool
pigeon classify \
aligned.bam \
reference.gtf \
reference.fa \
-o pigeon_output
# Produces count matrix and classification
pigeon report pigeon_output_classification.txt
# Merge Iso-Seq with reference annotation
# First, convert to TAMA format
tama_format_convert.py \
-i collapsed.gtf \
-f gtf \
-o isoseq.bed
# Create file list
echo -e "isoseq.bed\tcapped\t1\t1" > file_list.txt
echo -e "reference.bed\tcapped\t1\t2" >> file_list.txt
# Merge annotations
tama_merge.py \
-f file_list.txt \
-p merged \
-a 50 \
-z 50 \
-m 10
Goal: Summarize Iso-Seq clustering results including isoform counts, read support, and transcript lengths.
Approach: Parse the cluster report CSV for per-isoform read counts and extract sequence lengths from the HQ FASTA.
import pysam
import pandas as pd
def parse_cluster_report(report_path):
df = pd.read_csv(report_path)
isoform_counts = df.groupby('cluster_id').size()
return isoform_counts
def get_transcript_lengths(fasta_path):
lengths = {}
with pysam.FastxFile(fasta_path) as fh:
for entry in fh:
lengths[entry.name] = len(entry.sequence)
return lengths
def summarize_isoseq(cluster_report, hq_fasta):
counts = parse_cluster_report(cluster_report)
lengths = get_transcript_lengths(hq_fasta)
print(f'Total isoforms: {len(counts)}')
print(f'Median support: {counts.median():.0f} reads')
print(f'Mean length: {sum(lengths.values())/len(lengths):.0f} bp')
return counts, lengths
library(IsoformSwitchAnalyzeR)
# Import SQANTI3 results
switchList <- importIsoformExpression(
isoformCountMatrix = 'counts.txt',
isoformRepExpression = 'tpm.txt',
designMatrix = design
)
# Add SQANTI3 annotations
switchList <- addORFfromFASTA(
switchList,
orfs = 'sqanti_corrected.fasta'
)
# Analyze switching
switchList <- isoformSwitchTestDEXSeq(switchList)
# Extract significant switches
sig_switches <- switchList$isoformSwitchAnalysis[
switchList$isoformSwitchAnalysis$padj < 0.05,
]
| Metric | Good | Acceptable | Poor |
|---|---|---|---|
| CCS passes | >3 | 2-3 | <2 |
| Full-length % | >80% | 60-80% | <60% |
| Clustering rate | >90% | 80-90% | <80% |
| FSM % | >50% | 30-50% | <30% |
| Novel isoforms | 10-30% | 30-50% | >50% (suspect) |
| Issue | Possible Cause | Solution |
|---|---|---|
| Low full-length % | Primer issues | Check primer sequences |
| High concatemer % | Library prep | Increase SMRTbell cleanup |
| Few FSM | Poor reference | Use comprehensive GTF |
| High NNC % | Novel biology or artifacts | Validate with orthogonal data |
| Low clustering | High diversity | Reduce clustering stringency |
# Using PacBio Docker images
docker run -v /data:/data \
quay.io/biocontainers/isoseq3:4.0.0--h9ee0642_0 \
isoseq3 cluster /data/refined.bam /data/clustered.bam
# SQANTI3 in Singularity
singularity exec sqanti3.sif \
sqanti3_qc.py input.fa ref.gtf ref.fa -o output