CRISPR library design for genetic screens. Covers sgRNA selection, library composition, control design, and oligo ordering. Use when designing custom sgRNA libraries for knockout, activation, or interference screens.
Reference examples tested with: BioPython 1.83+, MAGeCK 0.5+, numpy 1.26+, pandas 2.2+
Before using code patterns, verify installed versions match. If versions differ:
pip show <package> then help(module.function) to check signaturesIf code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
"Design a custom CRISPR library for my screen" → Select optimal sgRNAs for knockout, CRISPRi/a, or base editing libraries with on-target scoring, off-target filtering, and control guide design.
BioPython for sequence handlingGoal: Score and rank candidate sgRNAs for a target gene based on design quality metrics.
Scan the gene sequence for PAM sites, extract 20-nt protospacer sequences, score each on GC content, poly-T avoidance, 5' G preference, and length, then return the top-ranked candidates.
import pandas as pd
import numpy as np
from Bio import SeqIO
from Bio.Seq import Seq
def score_sgrna(sequence, pam='NGG'):
'''Score sgRNA based on multiple criteria.'''
scores = {}
gc_content = (sequence.count('G') + sequence.count('C')) / len(sequence)
scores['gc_content'] = 1 - abs(gc_content - 0.5) * 2
if len(sequence) >= 4:
has_poly_t = 'TTTT' in sequence
scores['poly_t'] = 0 if has_poly_t else 1
starts_with_g = sequence.startswith('G')
scores['start_g'] = 1 if starts_with_g else 0.5
scores['length'] = 1 if len(sequence) == 20 else 0.8
overall = np.mean(list(scores.values()))
return overall, scores
def design_sgrnas_for_gene(gene_sequence, n_guides=4, pam='NGG'):
'''Design sgRNAs targeting a gene.'''
candidates = []
pam_pattern = pam.replace('N', '[ACGT]')
import re
for strand in ['+', '-']:
seq = gene_sequence if strand == '+' else str(Seq(gene_sequence).reverse_complement())
for match in re.finditer(f'([ACGT]{{20}})({pam_pattern})', seq):
sgrna = match.group(1)
position = match.start()
if strand == '-':
position = len(seq) - position - 23
score, details = score_sgrna(sgrna)
candidates.append({
'sequence': sgrna,
'pam': match.group(2),
'strand': strand,
'position': position,
'score': score,
'gc_content': (sgrna.count('G') + sgrna.count('C')) / 20,
**details
})
candidates_df = pd.DataFrame(candidates)
candidates_df = candidates_df.sort_values('score', ascending=False)
return candidates_df.head(n_guides)
gene_seq = 'ATGCGATCGATCGATCGATCGAATCGATCGATCGAGGCGATCGATCGATCGATCGAATCGATCGATCGAGGCGATCGATCGATCGATCGAATCGATCGATCGAGG'
guides = design_sgrnas_for_gene(gene_seq, n_guides=5)
print(guides[['sequence', 'position', 'strand', 'score', 'gc_content']])
Goal: Assemble a complete sgRNA library targeting a list of genes with appropriate controls.
Approach: Design top-scoring guides for each gene, append non-targeting, essential-control, and safe-harbor-control guides, and compile into an ordered library table.
def design_library(gene_list, guides_per_gene=4, include_controls=True):
'''Design complete library for gene list.'''
library = []
for gene in gene_list:
gene_data = get_gene_sequence(gene)
guides = design_sgrnas_for_gene(gene_data['sequence'], n_guides=guides_per_gene)
for idx, guide in guides.iterrows():
library.append({
'gene': gene,
'gene_id': gene_data.get('ensembl_id', ''),
'guide_number': idx + 1,
'sequence': guide['sequence'],
'pam': guide['pam'],
'position': guide['position'],
'strand': guide['strand'],
'score': guide['score'],
'type': 'targeting'
})
if include_controls:
controls = design_control_guides()
library.extend(controls)
return pd.DataFrame(library)
def get_gene_sequence(gene_name):
'''Fetch gene sequence (placeholder - use Ensembl API or local files).'''
return {
'sequence': 'ATGC' * 250,
'ensembl_id': f'ENSG_{hash(gene_name) % 100000:05d}'
}
genes = ['TP53', 'BRCA1', 'KRAS', 'MYC', 'CDK4']
library = design_library(genes, guides_per_gene=4)
print(f'Library size: {len(library)} guides')
print(f'Genes: {library["gene"].nunique()}')
Goal: Design control guide sets for normalization and quality assessment in CRISPR screens.
Approach: Generate random non-targeting sequences with acceptable GC content, add validated guides against known essential genes (positive controls) and safe-harbor loci (negative controls).
def design_control_guides(n_nontargeting=100, n_essential=20, n_nonessential=20):
'''Design control guides for library.'''
controls = []
for i in range(n_nontargeting):
sequence = generate_nontargeting_sequence()
controls.append({
'gene': f'NonTargeting_{i+1}',
'gene_id': '',
'guide_number': 1,
'sequence': sequence,
'pam': 'NGG',
'position': -1,
'strand': '',
'score': 0,
'type': 'non-targeting'
})
essential_genes = ['RPS3', 'RPL11', 'EIF3A', 'POLR2A', 'CDK1']
for gene in essential_genes[:n_essential]:
controls.append({
'gene': gene,
'gene_id': '',
'guide_number': 1,
'sequence': get_validated_guide(gene),
'pam': 'NGG',
'position': 0,
'strand': '+',
'score': 1,
'type': 'essential-control'
})
nonessential_genes = ['AAVS1', 'ROSA26']
for gene in nonessential_genes[:n_nonessential]:
controls.append({
'gene': gene,
'gene_id': '',
'guide_number': 1,
'sequence': get_validated_guide(gene),
'pam': 'NGG',
'position': 0,
'strand': '+',
'score': 1,
'type': 'safe-harbor-control'
})
return controls
def generate_nontargeting_sequence(length=20):
'''Generate random non-targeting sequence.'''
while True:
seq = ''.join(np.random.choice(['A', 'C', 'G', 'T'], length))
gc = (seq.count('G') + seq.count('C')) / length
if 0.4 <= gc <= 0.6 and 'TTTT' not in seq:
return seq
def get_validated_guide(gene):
'''Get validated guide sequence for control gene.'''
validated = {
'RPS3': 'GAGCTTCTTCAGCAGCATGG',
'RPL11': 'GAAACAGGGCATCATCTACG',
'EIF3A': 'GTGCAAGAGGATGATGACAA',
'AAVS1': 'GGGGCCACTAGGGACAGGAT',
'ROSA26': 'GAAGATGGGCGGGAGTCTTC'
}
return validated.get(gene, generate_nontargeting_sequence())
Goal: Filter library guides to remove those with excessive off-target genomic matches.
Approach: Align each guide sequence against the genome with Bowtie allowing mismatches, count off-target hits within a mismatch threshold, and remove guides exceeding the maximum.
def check_offtargets(guide_sequence, genome_index, max_mismatches=3):
'''Check for potential off-target sites.'''
from subprocess import run
import tempfile
with tempfile.NamedTemporaryFile(mode='w', suffix='.fa', delete=False) as f:
f.write(f'>guide\n{guide_sequence}\n')
query_file = f.name
result = run(
['bowtie', '-a', '-n', str(max_mismatches), '-l', '20', genome_index, '-f', query_file],
capture_output=True, text=True
)
offtargets = []
for line in result.stdout.strip().split('\n'):
if line:
fields = line.split('\t')
offtargets.append({
'chromosome': fields[2],
'position': int(fields[3]),
'strand': fields[1],
'mismatches': int(fields[7]) if len(fields) > 7 else 0
})
return offtargets
def filter_by_offtargets(library_df, genome_index, max_offtargets=10):
'''Filter library to remove guides with too many off-targets.'''
filtered = []
for _, guide in library_df.iterrows():
offtargets = check_offtargets(guide['sequence'], genome_index)
n_offtargets = len([ot for ot in offtargets if ot['mismatches'] <= 2])
if n_offtargets <= max_offtargets:
guide_dict = guide.to_dict()
guide_dict['n_offtargets'] = n_offtargets
filtered.append(guide_dict)
return pd.DataFrame(filtered)
Goal: Generate forward and reverse oligo sequences ready for ordering and cloning into a lentiviral vector.
Approach: Add vector-specific adapter sequences (overhangs for BsmBI or BbsI restriction sites) to each guide and its reverse complement, formatted for the target vector backbone.
def design_oligos(library_df, vector='lentiGuide-Puro'):
'''Design oligos for library cloning.'''
vector_specs = {
'lentiGuide-Puro': {
'forward_prefix': 'CACCG',
'forward_suffix': '',
'reverse_prefix': 'AAAC',
'reverse_suffix': 'C'
},
'pLKO': {
'forward_prefix': 'CCGG',
'forward_suffix': 'CTCGAG',
'reverse_prefix': 'AATTCTCGAG',
'reverse_suffix': ''
}
}
spec = vector_specs.get(vector, vector_specs['lentiGuide-Puro'])
oligos = []
for _, guide in library_df.iterrows():
seq = guide['sequence']
forward = spec['forward_prefix'] + seq + spec['forward_suffix']
reverse = spec['reverse_prefix'] + str(Seq(seq).reverse_complement()) + spec['reverse_suffix']
oligos.append({
'guide_id': f"{guide['gene']}_{guide['guide_number']}",
'gene': guide['gene'],
'guide_sequence': seq,
'forward_oligo': forward,
'reverse_oligo': reverse,
'type': guide.get('type', 'targeting')
})
return pd.DataFrame(oligos)
oligos = design_oligos(library)
oligos.to_csv('library_oligos.csv', index=False)
print(f'Designed {len(oligos)} oligo pairs')
def design_array_oligos(library_df, array_format='12K'):
'''Design array oligos for pooled synthesis.'''
formats = {
'12K': {'capacity': 12000, 'length': 200},
'92K': {'capacity': 92000, 'length': 150},
'244K': {'capacity': 244000, 'length': 60}
}
spec = formats[array_format]
primer_5 = 'AGGCTTGGATTTCTATAACTTCGTATAGCATACATTATACGAAGTTAT'
primer_3 = 'ATAACTTCGTATAATGTATGCTATACGAAGTTATCTTGGATTTCTAGA'
scaffold = 'GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC'
array_oligos = []
for _, guide in library_df.iterrows():
full_oligo = primer_5 + guide['sequence'] + scaffold + primer_3
if len(full_oligo) > spec['length']:
print(f"Warning: {guide['gene']} oligo too long for {array_format}")
continue
array_oligos.append({
'id': f"{guide['gene']}_{guide['guide_number']}",
'sequence': full_oligo,
'length': len(full_oligo)
})
if len(array_oligos) > spec['capacity']:
print(f"Warning: Library ({len(array_oligos)}) exceeds {array_format} capacity ({spec['capacity']})")
return pd.DataFrame(array_oligos)
array_oligos = design_array_oligos(library, '92K')
array_oligos.to_csv('array_synthesis.csv', index=False)
def qc_library(library_df):
'''Quality control checks for library design.'''
qc = {}
qc['total_guides'] = len(library_df)
qc['unique_genes'] = library_df[library_df['type'] == 'targeting']['gene'].nunique()
qc['guides_per_gene'] = library_df[library_df['type'] == 'targeting'].groupby('gene').size().describe()
gc_contents = library_df['sequence'].apply(lambda x: (x.count('G') + x.count('C')) / len(x))
qc['gc_mean'] = gc_contents.mean()
qc['gc_std'] = gc_contents.std()
qc['gc_range'] = (gc_contents.min(), gc_contents.max())
has_poly_t = library_df['sequence'].apply(lambda x: 'TTTT' in x)
qc['poly_t_count'] = has_poly_t.sum()
type_counts = library_df['type'].value_counts()
qc['control_ratio'] = type_counts.get('non-targeting', 0) / len(library_df)
return qc
qc = qc_library(library)
print('Library QC:')
for key, value in qc.items():
print(f' {key}: {value}')
The examples above use SpCas9 with NGG PAM. Alternative systems expand targeting range:
| System | PAM | Use Case |
|---|---|---|
| SpCas9 | NGG | Standard, most validated |
| SpCas9-NG | NG | Relaxed PAM requirement |
| SpRY | NRN/NYN | Near-PAMless, broadest targeting |
| Cas12a (Cpf1) | TTTV | AT-rich regions, staggered cuts |
| SaCas9 | NNGRRT | AAV delivery (smaller gene) |
For alternative PAMs, modify the design_sgrnas_for_gene() function:
# Cas12a example (TTTV PAM, 23nt guide)
def design_cas12a_guides(gene_sequence, n_guides=4):
pam_pattern = 'TTT[ACG]' # TTTV
guide_length = 23
for match in re.finditer(f'({pam_pattern})([ACGT]{{{guide_length}}})', gene_sequence):
pam = match.group(1)
guide = match.group(2)
# Cas12a cuts downstream of guide
# ...