Biopython

Reference guides (if present in this repository) can be consulted for deeper module-specific patterns:

• references/sequence_io.md
• references/alignment.md
• references/databases.md
• references/blast.md
• references/structure.md
• references/phylogenetics.md
• references/advanced.md

Dependencies

• Python >= 3.8 (Biopython 1.85 supports Python 3)
• biopython==1.85
• numpy>=1.20 (required by Biopython)

Install:

python -m pip install "biopython==1.85" "numpy>=1.20"

Example Usage

A complete, runnable example that:

1. parses a FASTA file,
2. computes GC fraction,
3. runs a remote BLAST (optional),
4. fetches the top hit from NCBI,
5. prints basic results.

Create example_biopython_pipeline.py:

from __future__ import annotations

import os
import time
from typing import Optional

from Bio import Entrez, SeqIO
from Bio.SeqUtils import gc_fraction

# Optional BLAST (remote). Comment out if you do not want network calls.
from Bio.Blast import NCBIWWW, NCBIXML


def configure_entrez() -> None:
    """
    NCBI requires an email. An API key increases rate limits.
    Set these via environment variables to avoid hardcoding secrets.
    """
    email = os.environ.get("NCBI_EMAIL")
    if not email:
        raise RuntimeError("Set NCBI_EMAIL env var (required by NCBI). Example: export NCBI_EMAIL='[email protected]'")
    Entrez.email = email

    api_key = os.environ.get("NCBI_API_KEY")
    if api_key:
        Entrez.api_key = api_key


def read_first_fasta_record(path: str):
    with open(path, "r", encoding="utf-8") as handle:
        return next(SeqIO.parse(handle, "fasta"))


def blast_top_accession(sequence: str, program: str = "blastn", database: str = "nt") -> Optional[str]:
    """
    Remote BLAST can be slow and rate-limited. For large-scale BLAST, prefer local BLAST+.
    """
    result_handle = NCBIWWW.qblast(program, database, sequence)
    blast_record = NCBIXML.read(result_handle)

    if not blast_record.alignments:
        return None

    # Many BLAST titles include multiple identifiers; accession is usually available directly.
    return blast_record.alignments[0].accession


def fetch_fasta_by_accession(accession: str) -> str:
    with Entrez.efetch(db="nucleotide", id=accession, rettype="fasta", retmode="text") as handle:
        return handle.read()


def main() -> None:
    configure_entrez()

    record = read_first_fasta_record("input.fasta")
    seq = record.seq

    print(f"ID: {record.id}")
    print(f"Length: {len(seq)}")
    print(f"GC fraction: {gc_fraction(seq):.2%}")

    # Be polite to NCBI services in batch workflows.
    time.sleep(0.34)

    top_acc = blast_top_accession(str(seq))
    if not top_acc:
        print("No BLAST hits found.")
        return

    print(f"Top BLAST accession: {top_acc}")

    time.sleep(0.34)
    fasta_text = fetch_fasta_by_accession(top_acc)
    print("Top hit FASTA:")
    print(fasta_text)


if __name__ == "__main__":
    main()

Run:

export NCBI_EMAIL="[email protected]"
# export NCBI_API_KEY="your_ncbi_api_key"  # optional
python example_biopython_pipeline.py

Provide an input.fasta in the same directory, e.g.:

>demo
ATCGATCGATCGATCGATCG

Implementation Details

• Streaming I/O for large datasets: Prefer iterator-based parsing (SeqIO.parse) to avoid loading entire files into memory. Use SeqIO.read only when exactly one record is expected.
• Entrez configuration and rate limits:
  • Always set Entrez.email (NCBI requirement).
  • Optionally set Entrez.api_key to increase request limits.
  • In batch jobs, add delays (e.g., time.sleep(0.34) as a conservative baseline) and implement retries for transient HTTP failures.
• BLAST considerations:
  • NCBIWWW.qblast(...) is convenient but can be slow and is not ideal for high-throughput workloads.
  • Parse results with NCBIXML.read(...) (single record) or NCBIXML.parse(...) (multiple records).
  • Filter hits by HSP metrics (e-value, identity) by iterating alignment.hsps.
• Sequence statistics and transformations:
  • Use Bio.SeqUtils.gc_fraction(seq) for GC fraction (returns 0–1).
  • Use seq.translate(table=...) with the correct genetic code table for reproducibility.
• Structure parsing (if used):
  • Use Bio.PDB.PDBParser(QUIET=True) to suppress warnings when appropriate.
  • Navigate the SMCRA hierarchy (Structure → Model → Chain → Residue → Atom) for robust traversal and geometry calculations.
• Reproducibility:
  • Record key parameters (file formats, translation table, BLAST program/database, e-value thresholds, NCBI query terms).
  • Cache downloaded records when iterating to avoid repeated network calls.3a:["$","$L43",null,{"content":"$44","frontMatter":{"name":"biopython","description":"A comprehensive toolbox for computational molecular biology; use it when you need programmatic sequence/structure parsing, batch bioinformatics pipelines, or automated NCBI/BLAST workflows.","license":"MIT","author":"aipoch","source":"aipoch","source_url":"https://github.com/aipoch/medical-research-skills"}}]